Skip to main content
Addgene

GST-prRDH-CTS
(Plasmid #86069)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86069 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEB
  • Backbone manufacturer
    Lu Lei (J Cell Sci. 2001)
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 5046
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Retinol dehydrogenase
  • Species
    B. taurus (bovine)
  • Mutation
    the insert is 297-312 of RDH8 (Bos taurus)
  • Entrez Gene
    RDH8
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5' GGCAAGCCACGTTTGGTG 3'
  • 3′ sequencing primer 5' GGAGCTGCATGTGTCAGAGG 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GST-prRDH-CTS was a gift from Lei Lu (Addgene plasmid # 86069 ; http://n2t.net/addgene:86069 ; RRID:Addgene_86069)
  • For your References section:

    A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000