CD8a-f-CTS-EGFP
(Plasmid #86063)

• Purpose: A mammalian expression plasmid encoding fibrocystin mimentic clone CD8a-f-CTS (CD8a luminal and transmembrane domains, fibrocystin ciliary targeting signal domains) with C-terminus EGFP.
• Depositing Lab: Lei Lu
• Publication: Madugula et al J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15.

Backbone

• Vector backbone: pEGFP-N3
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5382
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Fibrocystin
• Species: M. musculus (mouse)
• Mutation: contains CD8a luminal and transmembrane domains along with ciliary targeting signal (3870-3887 amino acids) of fibrocystin
• Entrez Gene: Pkhd1 (a.k.a. FPC, Tigm1)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5' CGCAAATGGGCGGTAGGCGTG 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry