CFFΔC-EGFP
(Plasmid
#86059)
-
PurposeA mammalian expression plasmid encoding fibrocystin mimentic clone CFFΔC (CD8a luminal domain, fibrocystin transmembrane and ciliary targeting signal) with C-terminus EGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5693
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFibrocystin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)663
-
Mutationcontains CD8a luminal and transmembrane domains along with amino acids 3849-3887 of fibrocystin
-
Entrez GenePkhd1 (a.k.a. FPC, Tigm1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer 5' CGCAAATGGGCGGTAGGCGTG 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The CD8A insert contains a C112Y mutation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CFFΔC-EGFP was a gift from Lei Lu (Addgene plasmid # 86059 ; http://n2t.net/addgene:86059 ; RRID:Addgene_86059) -
For your References section:
A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000