Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GST-thr-RAF1-RBD
(Plasmid #86033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86033 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDest-521
  • Backbone manufacturer
    in-house
  • Backbone size w/o insert (bp) 5516
  • Total vector size (bp) 6770
  • Modifications to backbone
    Derivative of pET43 modified for Gateway recombinational cloning
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RAF1 RBD (Ras-binding domain)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1154
  • Mutation
    Contains residues 1-149
  • Entrez Gene
    RAF1 (a.k.a. CMD1NN, CRAF, NS5, Raf-1, c-Raf)
  • Promoter T7
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTAATACGACTCACTATAGGGG
  • 3′ sequencing primer ggtggtgctcgagatcctctggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

modified from a plasmid described originally in Taylor and Shalloway (1996), Current Biology 6(12): 1621-27. This construct contains an E. coli optimized DNA sequence to improve expression and Gateway elements for recombinational cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GST-thr-RAF1-RBD was a gift from Dominic Esposito (Addgene plasmid # 86033 ; http://n2t.net/addgene:86033 ; RRID:Addgene_86033)