GST-thr-RAF1-RBD
(Plasmid #86033)

• Purpose: Expresses the RAS-binding domain of RAF1 for in vitro analysis of RAS activation
• Depositing Lab: Dominic Esposito
• Publication: FNLCR RAS Initiative (unpublished)

Backbone

• Vector backbone: pDest-521
• Backbone manufacturer: in-house
• Backbone size w/o insert (bp): 5516
• Total vector size (bp): 6770
• Modifications to backbone: Derivative of pET43 modified for Gateway recombinational cloning
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RAF1 RBD (Ras-binding domain)
• Species: H. sapiens (human)
• Insert Size (bp): 1154
• Mutation: Contains residues 1-149
• Entrez Gene: RAF1 (a.k.a. CMD1NN, CRAF, NS5, Raf-1, c-Raf)
• Promoter: T7
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TTAATACGACTCACTATAGGGG
• 3′ sequencing primer: ggtggtgctcgagatcctctggg

Resource Information

• Supplemental Documents:
  • R702-X43-521.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

modified from a plasmid described originally in Taylor and Shalloway (1996), Current Biology 6(12): 1621-27. This construct contains an E. coli optimized DNA sequence to improve expression and Gateway elements for recombinational cloning.