AAT_g1 gRNA
(Plasmid
#86005)
-
Purposeplasmid vector encoding for U6-driven AAT_g1 gRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEX-A
- Backbone size w/o insert (bp) 2450
- Total vector size (bp) 2870
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepU6-AAT_g1 sgRNA
-
gRNA/shRNA sequenceCACAGCCTTATGCACGGCC
- Promoter pU6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGGATAACAATTTCACACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains a 35 bp sequence encoding an attB2 site. This sequence was included during the synthesis of this plasmid, but the depositing laboratory has tested the construct experimentally and has confirmed that its function is not affected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAT_g1 gRNA was a gift from Tobias Cantz (Addgene plasmid # 86005 ; http://n2t.net/addgene:86005 ; RRID:Addgene_86005) -
For your References section:
Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Eggenschwiler R, Moslem M, Fraguas MS, Galla M, Papp O, Naujock M, Fonfara I, Gensch I, Wahner A, Beh-Pajooh A, Mussolino C, Tauscher M, Steinemann D, Wegner F, Petri S, Schambach A, Charpentier E, Cathomen T, Cantz T. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. 10.1038/srep38198 PubMed 27910942