AAT-PB-CD2APtk
(Plasmid
#86004)
-
Purposehomology donor for AAT locus with piggyBac-flanked DsRedEx_T2A_puroTK cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86004 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
-
Vector typeMammalian Expression ; piggyBac exciseable
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDsRedEx_T2A_puro_dTK
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCCTGGGCAACGTGCTGGTTATTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAT-PB-CD2APtk was a gift from Tobias Cantz (Addgene plasmid # 86004 ; http://n2t.net/addgene:86004 ; RRID:Addgene_86004) -
For your References section:
Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Eggenschwiler R, Moslem M, Fraguas MS, Galla M, Papp O, Naujock M, Fonfara I, Gensch I, Wahner A, Beh-Pajooh A, Mussolino C, Tauscher M, Steinemann D, Wegner F, Petri S, Schambach A, Charpentier E, Cathomen T, Cantz T. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. 10.1038/srep38198 PubMed 27910942