pMJ117
(Plasmid #85997)

• Purpose: One-guide Perturb-seq vector backbone; modified human U6 promoter; constant region 3
• Depositing Lab: Jonathan Weissman
• Publication: Adamson et al Cell. 2016 Dec 15;167(7):1867-1882.e21. doi: 10.1016/j.cell.2016.11.048.

Backbone

• Vector backbone: pSICO derivative
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 8200
• Total vector size (bp): 9146
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: EGFP-NT2_cr3
• gRNA/shRNA sequence: GFP
• Insert Size (bp): 113
• Promoter: modified human U6

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACGGCGACTACTGCACTTAT
• 3′ sequencing primer: gtacctagtggaaccggaac

Gene/Insert 2

• Gene/Insert name: puro-T2A-BFP
• gRNA/shRNA sequence: NA
• Insert Size (bp): 1371

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments