Skip to main content
Addgene

pUC:FCP:ShBle:FCP:EGFP
(Plasmid #85987)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85987 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Unknown
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    ShBle
  • Alt name
    Zeocin resistance
  • Promoter FCP

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    EGFP
  • Species
    jellyfish
  • Promoter FCP

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer EXFP-R
  • 3′ sequencing primer EXFP-internal-F (ACGACGGCAACTACAAGACC)
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The FCP promoter and terminator were amplified from Fragilariopsis cylindrus gDNA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC:FCP:ShBle:FCP:EGFP was a gift from Thomas Mock (Addgene plasmid # 85987 ; http://n2t.net/addgene:85987 ; RRID:Addgene_85987)

  • For your References section:

    Genetic tool development in marine protists: emerging model organisms for experimental cell biology. Faktorova D, Nisbet RER, Fernandez Robledo JA, Casacuberta E, Sudek L, Allen AE, Ares M Jr, Areste C, Balestreri C, Barbrook AC, Beardslee P, Bender S, Booth DS, Bouget FY, Bowler C, Breglia SA, Brownlee C, Burger G, Cerutti H, Cesaroni R, Chiurillo MA, Clemente T, Coles DB, Collier JL, Cooney EC, Coyne K, Docampo R, Dupont CL, Edgcomb V, Einarsson E, Elustondo PA, Federici F, Freire-Beneitez V, Freyria NJ, Fukuda K, Garcia PA, Girguis PR, Gomaa F, Gornik SG, Guo J, Hampl V, Hanawa Y, Haro-Contreras ER, Hehenberger E, Highfield A, Hirakawa Y, Hopes A, Howe CJ, Hu I, Ibanez J, Irwin NAT, Ishii Y, Janowicz NE, Jones AC, Kachale A, Fujimura-Kamada K, Kaur B, Kaye JZ, Kazana E, Keeling PJ, King N, Klobutcher LA, Lander N, Lassadi I, Li Z, Lin S, Lozano JC, Luan F, Maruyama S, Matute T, Miceli C, Minagawa J, Moosburner M, Najle SR, Nanjappa D, Nimmo IC, Noble L, Novak Vanclova AMG, Nowacki M, Nunez I, Pain A, Piersanti A, Pucciarelli S, Pyrih J, Rest JS, Rius M, Robertson D, Ruaud A, Ruiz-Trillo I, Sigg MA, Silver PA, Slamovits CH, Jason Smith G, Sprecher BN, Stern R, Swart EC, Tsaousis AD, Tsypin L, Turkewitz A, Turnsek J, Valach M, Verge V, von Dassow P, von der Haar T, Waller RF, Wang L, Wen X, Wheeler G, Woods A, Zhang H, Mock T, Worden AZ, Lukes J. Nat Methods. 2020 May;17(5):481-494. doi: 10.1038/s41592-020-0796-x. Epub 2020 Apr 6. 10.1038/s41592-020-0796-x PubMed 32251396
Related items: