pICH47732:FCP:NAT
(Plasmid #85984)

• Purpose: Golden Gate Level 1 cassette encoding a Nat selectable marker under the FCP promoter
• Depositing Lab: Thomas Mock
• Publication: Hopes et al Plant Methods. 2016 Nov 24;12:49. doi: 10.1186/s13007-016-0148-0. eCollection 2016.

Backbone

• Vector backbone: pICH47732
• Backbone manufacturer: Sylvestre Marillonnet (Addgene #48000)
• Vector type: Golden Gate Assembly
• Selectable markers: Nourseothricin (Nat)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Addgene recommends screening 2-3 colonies via restriction digest before creating a glycerol stock.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NAT
• Alt name: nourseothricin acetyltransferase
• Species: Thalassiosira pseudonana
• Promoter: FCP

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: NrsR-F (TGACCACTCTTGACGACACG)
• 3′ sequencing primer: pBluescript-SK

Resource Information

• Supplemental Documents:
  • pICH47732 TP Fcp NAT.gb
• A portion of this plasmid was derived from a plasmid made by: pTpFCP/NAT described in Poulsen N, Chesley PM, Kröger N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), was domesticated by removing BsaI and BpiI sites through site directed mutagenesis. The domesticated FCP:NAT cassette was then inserted into an L1 pICH47732 vector.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was assembled using Golden Gate Cloning as described in Hopes et al., 2016.