pAGM4723:TpCC_Urease
(Plasmid #85982)

• Purpose: Golden Gate Level 2 construct encoding Cas9-YFP and 2 urease-targeting gRNAs
• Depositing Lab: Thomas Mock
• Publication: Hopes et al Plant Methods. 2016 Nov 24;12:49. doi: 10.1186/s13007-016-0148-0. eCollection 2016.

Backbone

• Vector backbone: pAGM4723
• Backbone manufacturer: Sylvestre Marillonnet (Addgene #48015)
• Vector type: CRISPR ; Diatom (T. pseudonana)
• Selectable markers: Nourseothricin (Nat)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Streptococcus pyogenes
• Promoter: FCP
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • YFP (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: hSpCas9-R1 (CGCTCGTGCTTCTTATCCTC)
• 3′ sequencing primer: EXFP-R

Gene/Insert 2

• Gene/Insert name: Urease-targeting gRNA 1
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: RB-F1 (ggataaaccttttcacgccc)

Gene/Insert 3

• Gene/Insert name: Urease-targeting gRNA 2
• Promoter: U6

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: RB-F1 (ggataaaccttttcacgccc)

Resource Information

• Supplemental Documents:
  • pAGM4723_Tp_FcpCas9YFP_Urease.gbk
• A portion of this plasmid was derived from a plasmid made by: The cassette from pTpFCP/NAT described in Poulsen N, Chesley PM, Kröger N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), was domesticated by removing BsaI and BpiI sites through site directed mutagenesis. This was then used as a template for the FCP promoter and terminator. The sgRNA scaffold was PCR amplified from Addgene #46966.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was assembled using Golden Gate Cloning as described in Hopes et al., 2016.