EZ-Tet-pLKO-Blast
(Plasmid #85973)

• Purpose: (Empty Backbone) Tet/Dox inducible shRNA lentivirus with blasticidin selection
• Depositing Lab: Cindy Miranti
• Publication: Frank et al BMC Biotechnol. 2017 Feb 28;17(1):24. doi: 10.1186/s12896-017-0341-x.

Backbone

• Vector backbone: EZ-Tet-pLKO-Puro
• Backbone size (bp): 8985
• Modifications to backbone: Cut out PuroR gene with BamHI and AatII and PCR subcloned in BlastR.
• Vector type: Lentiviral, RNAi
• Promoter: H1 / TetO
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Cloning Information

• 5′ sequencing primer: ATTAGTGAACGGATCTCGACGG
• 3′ sequencing primer: AACCCAGGGCTGCCTTGG

Resource Information

• Supplemental Documents:
  • EZ-Tet-pLKO-Blast.gb
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for Cloning Grade DNA (Catalog # 85973-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here