EZ-Tet-pLKO-Puro
(Plasmid #85966)

• Purpose: (Empty Backbone) Tet/Dox inducible shRNA lentivirus with puromycin selection
• Depositing Lab: Cindy Miranti
• Publication: Frank et al BMC Biotechnol. 2017 Feb 28;17(1):24. doi: 10.1186/s12896-017-0341-x.

Backbone

• Vector backbone: Tet-pLKO-Puro
• Backbone manufacturer: Dmitri Wiederschain
• Backbone size (bp): 10633
• Modifications to backbone: Shrunk stuffer and changed 5' cloning site from AgeI to NheI.
• Vector type: Lentiviral, RNAi
• Promoter: H1 / TetO
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Cloning Information

• 5′ sequencing primer: ATTAGTGAACGGATCTCGACGG
• 3′ sequencing primer: AACCCAGGGCTGCCTTGG

Resource Information

• Supplemental Documents:
  • EZ-Tet-pLKO-Puro.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 16 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Modified from Wiederschain et al., Addgene plasmid #21915

Information for Cloning Grade DNA (Catalog # 85966-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here