Skip to main content
Addgene

AB.pCCL.sin.cPPT.GFP.miR-583.sensor.PGK.dNGFR.WPRE
(Plasmid #85856)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85856 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AB.pCCL.sin.cPPT.GFP.PGK.dNGFR.WPRE
  • Backbone size w/o insert (bp) 9309
  • Total vector size (bp) 9480
  • Vector type
    Lentiviral
  • Selectable markers
    eGFP, NGFR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-583 Sensor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    171
  • Entrez Gene
    MIR583 (a.k.a. MIRN583, hsa-mir-583)
  • Promoter PKG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer AACAGACATACAAACTAAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AB.pCCL.sin.cPPT.GFP.miR-583.sensor.PGK.dNGFR.WPRE was a gift from Brian Brown (Addgene plasmid # 85856 ; http://n2t.net/addgene:85856 ; RRID:Addgene_85856)
  • For your References section:

    High-throughput assessment of microRNA activity and function using microRNA sensor and decoy libraries. Mullokandov G, Baccarini A, Ruzo A, Jayaprakash AD, Tung N, Israelow B, Evans MJ, Sachidanandam R, Brown BD. Nat Methods. 2012 Jul 1;9(8):840-6. doi: 10.1038/nmeth.2078. 10.1038/nmeth.2078 PubMed 22751203