hSyn Marina-T2A-nls-mCherry
(Plasmid #85843)

• Purpose: genetically-encoded fluorescent voltage indicator
• Depositing Lab: Vincent Pieribone
• Publication: Platisa et al ACS Chem Neurosci. 2017 Jan 3. doi: 10.1021/acschemneuro.6b00234.

Backbone

• Vector backbone: pCS2+ hSyn1
• Backbone size w/o insert (bp): 4372
• Total vector size (bp): 5833
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GEVI Marina
• Species: Ciona intestinalis
• Insert Size (bp): 1461
• Mutation: Ci-VSP contains R217Q mutation; super ecliptic pHluorin contains D147A, H148A, Y200V, A227D mutations. These mutations cause depolarization dependent increase in fluorescence intensity. The A227D mutation increases the fluorescence response magnitude. We replaced residues 71-91 within CiVSD with an amino acid sequence (KSRITSEGEYIPLDQIDINV) from the Kir2.1 channel Golgi-to-plasma membrane trafficking signal. The Kir 2.1 channel ER export signal sequence (FCYENEV) was added to C-terminus of super ecliptic pHluorin. The sequence is codon optimized using mammalian codon preference.
• GenBank ID: AB183035 AY533296
• Promoter: hSyn1
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: AGTCGTGTCGTGCCTGAGAG
• 3′ sequencing primer: ccttgagcatctgacttctggcta

Resource Information

• Supplemental Documents:
  • pCS2+ hSyn Marina-T2A-nls-mCherry .gb
• A portion of this plasmid was derived from a plasmid made by: Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A portion of this plasmid was derived from a plasmid made by Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.