CMV epArcLight
(Plasmid #85803)

• Purpose: genetically-encoded fluorescent voltage indicator
• Depositing Lab: Vincent Pieribone
• Publication: Platisa et al ACS Chem Neurosci. 2017 Jan 3. doi: 10.1021/acschemneuro.6b00234.

Backbone

• Vector backbone: pCS2+ CMV
• Backbone size w/o insert (bp): 5694
• Total vector size (bp): 7167
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: epArcLight
• Alt name: CiVSD-ecliptic pHluorin
• Alt name: CiSP
• Alt name: ecliptic pHluorin
• Species: Ciona intestinalis
• Mutation: Ci-VSP contains R217Q mutation; ecliptic pHluorin contains A227D mutation. The A227D mutation increases the fluorescence response magnitude.
• GenBank ID: AB183035 AF058695.1
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: SP6
• 3′ sequencing primer: tgcgtgtggttcgattagcaag

Resource Information

• Supplemental Documents:
  • pCS2+ CiVSD-Ecliptic pHluorin (Hygro).gb
• A portion of this plasmid was derived from a plasmid made by: Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A portion of this plasmid was derived from a plasmid made by Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.