pKIR1.1
(Plasmid #85758)

• Purpose: CRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter
• Depositing Lab: Tetsuya Higashiyama
• Publication: Tsutsui et al Plant Cell Physiol. 2016 Nov 17. pii: pcw191.

Backbone

• Vector backbone: pFAST-R01
• Backbone manufacturer: Prof. Ikuko Hara-Nishimura
• Total vector size (bp): 18518
• Modifications to backbone: AtU6.26p::AarIx2:sgRNA is inserted.
• Vector type: Plant Expression, CRISPR
• Selectable markers: Hygromycin ; TagRFP in seeds

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human-codon-optimized SpCas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4101
• Promoter: AtRPS5A
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: atggactataaggaccacgac

Resource Information

• Supplemental Documents:
  • pKIR1.1.gb
  • Details of CRISPR/Cas9 vectors (pKAMA-ITACHI)
• A portion of this plasmid was derived from a plasmid made by: human-codon-optimized SpCas9 was closed from pX330-U6-Chimeric_BB-CBh-hSpCas9 (item #42230) that we bought from Addgene on 6th June, 2013 by Prof. Tetsuya Higashiyama
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Right border (RB) may be truncated in the T-DNA integration. This may result in sgRNA scaffold truncation because the RB is close to 3' end of sgRNA. However, since we efficiently obtained knockout mutants by this vector, the truncation is not serious problem.

To overcome it, we also deposited pKI1.1R. In pKI1.1R, sgRNA is not close to RB.