pEJS476-pHAGE-TO-Nme dCas9 3XGFP-SgRNA/Telomere-All-in-one
(Plasmid #85716)

• Purpose: Expresses dNmeCas9-3XsfGFP and telomere-targeting Nme sgRNA
• Depositing Lab: Erik Sontheimer
• Publication: Pawluk et al Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8.

Backbone

• Vector backbone: pHAGE-DEST
• Total vector size (bp): 12560
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Nme dCas9
• Species: Synthetic
• Insert Size (bp): 3243
• Promoter: CMV-TO
• Tag / Fusion Protein:
  • 3XsfGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgaaggaatagaagaagaaggtgga
• 3′ sequencing primer: CCAAAGGGAGATCCGACTCG

Gene/Insert 2

• Gene/Insert name: telomere sgRNA
• Species: H. sapiens (human)
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCATATACGATACAAGGCTGT

Resource Information

• Supplemental Documents:
  • p476-pHAGE-TO-Nme dCas9 3XGFP-SgRNA Telomere-All-in-one.gb
• A portion of this plasmid was derived from a plasmid made by: pHAGE-TO-nmdCas9-3XGFP was a gift from Thoru Pederson (Addgene plasmid # 64109).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Multicolor CRISPR labeling of chromosomal loci in human cells. Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. 10.1073/pnas.1420024112 PubMed 25713381