Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSico shMAP3K2 mouse
(Plasmid #85657)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85657 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSico
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA targeting 3'UTR of Map3k2
  • Alt name
    mitogen-activated protein kinase kinase kinase 2
  • gRNA/shRNA sequence
    TAGTCATAGCTATAGTGAAATTCAAGAGATTTCACTATAGCTATGACTTTTTTTC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Map3k2 (a.k.a. 9630061B06Rik, AI585793, Mekk2, Mekk2b)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSico shMAP3K2 mouse was a gift from Julien Sage (Addgene plasmid # 85657 ; http://n2t.net/addgene:85657 ; RRID:Addgene_85657)
  • For your References section:

    SMYD3 links lysine methylation of MAP3K2 to Ras-driven cancer. Mazur PK, Reynoird N, Khatri P, Jansen PW, Wilkinson AW, Liu S, Barbash O, Van Aller GS, Huddleston M, Dhanak D, Tummino PJ, Kruger RG, Garcia BA, Butte AJ, Vermeulen M, Sage J, Gozani O. Nature. 2014 Jun 12;510(7504):283-7. doi: 10.1038/nature13320. Epub 2014 May 21. 10.1038/nature13320 PubMed 24847881