pSico shMAP3K2 human
(Plasmid
#85656)
-
Purposeexpression of shRNA targeting human MAP3K2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSico
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA targeting 3'UTR of MAP3K2
-
Alt namemitogen-activated protein kinase kinase kinase 2
-
gRNA/shRNA sequenceTGGATGATTTCACTAGGCATTTCAAGAGAATGCCTAGTGAAATCATCCTTTTTTC
-
SpeciesH. sapiens (human)
-
Entrez GeneMAP3K2 (a.k.a. MEKK2, MEKK2B)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer mU6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSico shMAP3K2 human was a gift from Julien Sage (Addgene plasmid # 85656 ; http://n2t.net/addgene:85656 ; RRID:Addgene_85656) -
For your References section:
SMYD3 links lysine methylation of MAP3K2 to Ras-driven cancer. Mazur PK, Reynoird N, Khatri P, Jansen PW, Wilkinson AW, Liu S, Barbash O, Van Aller GS, Huddleston M, Dhanak D, Tummino PJ, Kruger RG, Garcia BA, Butte AJ, Vermeulen M, Sage J, Gozani O. Nature. 2014 Jun 12;510(7504):283-7. doi: 10.1038/nature13320. Epub 2014 May 21. 10.1038/nature13320 PubMed 24847881