-
PurposeInducible dCas9 integration vector for Bacillus subtilis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAX01 (ColE1)
- Backbone size w/o insert (bp) 7800
- Total vector size (bp) 12000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)HI-Control 10G
-
Growth instructionsUse 0.5 ug/mL erythromycin for cloning in B. subtilis
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedcas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4107
- Promoter PxylA (B. megaterium)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SbfI (not destroyed)
- 5′ sequencing primer AAGATAGTTGATGGATAAACTTGTTCAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypdCas9-bacteria, Stanley Qi
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAW019-2 was a gift from Perry Chou (Addgene plasmid # 85614 ; http://n2t.net/addgene:85614 ; RRID:Addgene_85614) -
For your References section:
Development of a CRISPR-Cas9 toolkit for comprehensive engineering of Bacillus subtilis. Westbrook AW, Moo-Young M, Chou CP. Appl Environ Microbiol. 2016 Jun 3. pii: AEM.01159-16. 10.1128/AEM.01159-16 PubMed 27260361