-
PurposeMulti-gRNA delivery vector containing ugtP-gRNA.P395T for Bacillus subtilis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemodified pIEFBPR (ColE1)
- Backbone size w/o insert (bp) 8069
- Total vector size (bp) 8172
-
Modifications to backbonePlease see corresponding manuscript for plasmid construction details.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)HI-Control 10G
-
Growth instructionsUse 90 ug/mL Sp for both organisms
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameugtP-gRNA.P395T
-
gRNA/shRNA sequenceaaggaaaaactgctggagat
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAW014-2 was a gift from Perry Chou (Addgene plasmid # 85612 ; http://n2t.net/addgene:85612 ; RRID:Addgene_85612) -
For your References section:
Development of a CRISPR-Cas9 toolkit for comprehensive engineering of Bacillus subtilis. Westbrook AW, Moo-Young M, Chou CP. Appl Environ Microbiol. 2016 Jun 3. pii: AEM.01159-16. 10.1128/AEM.01159-16 PubMed 27260361