Addgene: pPEPX-P3-sgRNAluc Skip to main content
Addgene

pPEPX-P3-sgRNAluc
(Plasmid #85590)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85590 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPEP1
  • Backbone size w/o insert (bp) 3245
  • Total vector size (bp) 3415
  • Modifications to backbone
    Chloramphenicol resistance marker was removed; gBlock of sgRNA targeting firefly luciferase encoding gene luc was inserted by BglII and BamHI digestion and ligation
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Spectinomycin 100 μg/ml
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting firefly luciferase encoding gene
  • Alt name
    sgRNAluc
  • Species
    Synthetic
  • Insert Size (bp)
    140
  • Promoter P3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TCTAGACGGTGATCAACACGCTAG
  • 3′ sequencing primer CGAGGGATTTGGTGATTCTTCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For information of vector pPEP1 and promoter of P3, please refer to
"Sorg RA, Kuipers OP, Veening JW (2014) Gene Expression Platform for Synthetic Biology in the Human Pathogen Streptococcus pneumoniae. ACS synthetic biology"

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPEPX-P3-sgRNAluc was a gift from Jan-Willem Veening (Addgene plasmid # 85590 ; http://n2t.net/addgene:85590 ; RRID:Addgene_85590)
  • For your References section:

    High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. Liu X, Gallay C, Kjos M, Domenech A, Slager J, van Kessel SP, Knoops K, Sorg RA, Zhang JR, Veening JW. Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449. PubMed 28490437