pPEPY-PF6-lacI
(Plasmid #85589)

• Purpose: Work as template for amplification of Streptococcus pneumoniae adapted lacI gene, which is flanked by up- and downstream sequence for integration in prsA locus in S. pneumoniae
• Depositing Lab: Jan-Willem Veening
• Publication: Liu et al Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449.

Backbone

• Vector backbone: pPEPY
• Backbone size w/o insert (bp): 2963
• Total vector size (bp): 5925
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Please notice that this vector is a container of lacI gene. Expression of lacI in E. coli makes the cells grow very slowly, So we recommend researcher do PCR with E. coli cells without isolating the plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: lacI
• Species: Synthetic
• Insert Size (bp): 2962
• Promoter: PF6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: CCCTAAATTTACTAAAGACACTGCTCA
• 3′ sequencing primer: TGATAGGGTGGTCTCCGATCG

Resource Information

• Supplemental Documents:
  • pPEPY-lacI-GmR.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For details of the lacI gene and promoter of PF6, please refer to "Robin Sorg, PhD thesis, Engineering Approaches to Investigate Pneumococcal Gene Expression Regulation and Antibiotic Resistance Development, 2016, ISBN: 978-90-367-9259-2"