pJWV102-PL-dCas9
(Plasmid #85588)

• Purpose: Integrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9sp
• Depositing Lab: Jan-Willem Veening
• Publication: Liu et al Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449.

Backbone

• Vector backbone: pJWV100
• Backbone size w/o insert (bp): 8273
• Total vector size (bp): 11911
• Modifications to backbone: gfp_sf gene was removed; dCas9sp gene driven by IPTG inducible promoter PL was inserted
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9sp
• Species: Streptococcus pyogenes
• Insert Size (bp): 4105
• Promoter: PLsp

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: TCTCATAGGCCGGCCTGTTAG
• 3′ sequencing primer: gctttgctataaatacgcttcacag

Resource Information

• Supplemental Documents:
  • pJWV102-PL-dCas9.gb
• A portion of this plasmid was derived from a plasmid made by: dCas9sp was amplified from plasmid Addgene #44249
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To find information of pJWV100, please refer to "Overkamp W, Beilharz K, Detert Oude Weme R, Solopova A, Karsens H, Kovacs A, Kok J, Kuipers OP, Veening JW (2013) Benchmarking various green fluorescent protein variants in Bacillus subtilis, Streptococcus pneumoniae, and Lactococcus lactis for live cell imaging. Applied and environmental microbiology 79: 6481-6490";
To find information of IPTG-inducible promoter, PL, please refer to "Robin Sorg, PhD thesis, Engineering Approaches to Investigate Pneumococcal Gene Expression Regulation and Antibiotic Resistance Development, 2016, ISBN: 978-90-367-9259-2"