Skip to main content
Addgene

pHW394 (15xUAS::GFP::let-858 3'UTR)
(Plasmid #85584)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85584 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPD117.01
  • Backbone manufacturer
    Fire Lab C. elegans Vector Kit
  • Backbone size w/o insert (bp) 2778
  • Total vector size (bp) 4493
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    15xUAS-delta pes-10-GFP
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    1715
  • Mutation
    GFP(S65C) with three introns for expression in C. elegans
  • Promoter 15xUAS-delta pes-10-GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer oHW10f TGAGCGGATAACAATTTCAC
  • 3′ sequencing primer oHW233r cgaattgggagacggaaagag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHW394 (15xUAS::GFP::let-858 3'UTR) was a gift from Paul Sternberg (Addgene plasmid # 85584 ; http://n2t.net/addgene:85584 ; RRID:Addgene_85584)
  • For your References section:

    cGAL, a temperature-robust GAL4-UAS system for Caenorhabditis elegans. Wang H, Liu J, Gharib S, Chai CM, Schwarz EM, Pokala N, Sternberg PW. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4109. 10.1038/nmeth.4109 PubMed 27992408