pTC-CMV-Tet-YAP
(Plasmid #85579)

• Purpose: Sleeping beauty transposon for hydrodynamic tail vein injection for CreER expression and tetracyclin-dependent YAP expression (CMV promoter ) in mouse liver
• Depositing Lab: Ursula Ehmer
• Publication: Hubner et al J Gene Med. 2016 Dec 23. doi: 10.1002/jgm.2940.

Backbone

• Vector backbone: pT3
• Backbone size w/o insert (bp): 3392
• Total vector size (bp): 11031
• Vector type: Mammalian Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CreER
• Insert Size (bp): 1985

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (unknown if destroyed)
• 3′ cloning site: MluI (unknown if destroyed)
• 5′ sequencing primer: seq intron fwd (TCTCCACAGGTGTCCACTCC)

Gene/Insert 2

• Gene/Insert name: YAP
• Alt name: Yes-assiciated protein
• Species: H. sapiens (human)
• Insert Size (bp): 1697
• GenBank ID: NC_000011.10
• Promoter: TRE
• Tag / Fusion Protein:
  • Flag (2x) (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pCEP fwd

Resource Information

• Supplemental Documents:
  • pTC-CMV-Tet-YAP.gb
• A portion of this plasmid was derived from a plasmid made by: CreER sequence originally from addgene plasmid #12168 YAP sequence originally from addgene plasmid #19045

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry