pTC-CMV-Tet
(Plasmid #85577)

• Purpose: Sleeping beauty transposon for hydrodynamic tail vein injection for CreER expression and tetracyclin-dependent transgene/shRNA expression (CMV promoter) in mouse liver
• Depositing Lab: Ursula Ehmer
• Publication: Hubner et al J Gene Med. 2016 Dec 23. doi: 10.1002/jgm.2940.

Backbone

• Vector backbone: pT3
• Backbone size w/o insert (bp): 3392
• Total vector size (bp): 10647
• Vector type: Mammalian Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CreER
• Insert Size (bp): 1985
• Promoter: ApoE.HCR.hAAT

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (unknown if destroyed)
• 3′ cloning site: MluI (unknown if destroyed)
• 5′ sequencing primer: seq intron fwd (TCTCCACAGGTGTCCACTCC)

Resource Information

• Supplemental Documents:
  • pTC-CMV-Tet.gb
• A portion of this plasmid was derived from a plasmid made by: CreER sequence originally from addgene plasmid #12168
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry