-
PurposePlasmid for incorporating the non-canonical amino acid para-aminoPhe with the Mj pAF synthetase and cognate amber suppressing tRNA in Ecoli.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85502 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDule
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namep-aminoPhe tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
-
Alt namepara-aminoPhenylalanine
-
Alt namepAF
-
Alt name4-aminoPhenylalanine
-
SpeciesMethanocaldococcus jannaschii
-
Insert Size (bp)921
-
MutationY32T, E107T, D158P, I159L, L162A
- Promoter lpp (constitutive)
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGTCACTGCGTCTTTTACTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid has been slightly modified from the original version (Mehl et al., 2003).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDule-para-aminoPhe was a gift from Ryan Mehl (Addgene plasmid # 85502 ; http://n2t.net/addgene:85502 ; RRID:Addgene_85502) -
For your References section:
Generation of a bacterium with a 21 amino acid genetic code. Mehl RA, Anderson JC, Santoro SW, Wang L, Martin AB, King DS, Horn DM, Schultz PG. J Am Chem Soc. 2003 Jan 29;125(4):935-9. 10.1021/ja0284153 PubMed 12537491