pDule-IBBN (G2)
(Plasmid #85500)

• Purpose: Plasmid for incorporating the non-canonical amino acid IBBN with the Mj IBBN (G2) synthetase and cognate amber suppressing tRNA in Ecoli.
• Depositing Lab: Ryan Mehl
• Publication: Peeler et al J Am Chem Soc. 2010 Oct 6;132(39):13575-7. doi: 10.1021/ja104493d.

Backbone

• Vector backbone: pDule
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 6300
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: IBBN (G2) synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
• Alt name: IBBA (G2) synthetase
• Alt name: Bibaf (G2) synthetase
• Species: Methanocaldococcus jannaschii
• Insert Size (bp): 921
• Mutation: Y32G L65E F108W Q109M D158S R162K
• Promoter: lpp (constitutive)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CGTCACTGCGTCTTTTACTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This synthetase is permissive and can incorporate a variety of amino acids structurally analogous to IBBN. For a more complete functional and structural analysis of this synthetase, also see Cooley et al. Chembiochem. 2014, 15(12): 1810–1819.