pDule2-Tet2.0
(Plasmid #85497)

• Purpose: Plasmid for incorporating the non-canonical amino acid Tetrazine 2.0 with the Mj Tet2.0 synthetase and cognate amber suppressing tRNA in Ecoli.
• Depositing Lab: Ryan Mehl
• Publication: Blizzard et al J Am Chem Soc. 2015 Aug 19;137(32):10044-7. doi: 10.1021/jacs.5b03275. Epub 2015 Aug 10.

Backbone

• Vector backbone: pDule2
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 6300
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Tetrazine2.0 tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
• Alt name: Tet2.0 synthetase
• Species: Methanocaldococcus jannaschii
• Insert Size (bp): 921
• Mutation: Y32G L65Q F108S Q109D D158S L162N
• Promoter: lpp (constitutive)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CGTCACTGCGTCTTTTACTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry