-
PurposeRepressilator with integrated reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSC101
- Total vector size (bp) 8766
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemCfp
- Promoter PRNAI
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACGGCCAGTGAATTCGAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemVenus
- Promoter PLtet
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tcttagacgtactcgagcacgagg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametetR
- Promoter PLlac
-
Tag
/ Fusion Protein
- ssrA (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer cctcgtgctcgagtacgtctaag (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namelacI
- Promoter PR
-
Tag
/ Fusion Protein
- ssrA (C terminal on insert)
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer gaaaactacgctttagcagcttaatctag (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namecI
- Promoter PLtet
-
Tag
/ Fusion Protein
- ssrA (C terminal on insert)
Cloning Information for Gene/Insert 5
- Cloning method Unknown
- 5′ sequencing primer n/a
- 3′ sequencing primer gcaacaccagaacagcccg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRepressilator from Michael Elowitz
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLPT20 was a gift from Johan Paulsson (Addgene plasmid # 85460 ; http://n2t.net/addgene:85460 ; RRID:Addgene_85460) -
For your References section:
Synchronous long-term oscillations in a synthetic gene circuit. Potvin-Trottier L, Lord ND, Vinnicombe G, Paulsson J. Nature. 2016 Oct 12;538(7626):514-517. doi: 10.1038/nature19841. 10.1038/nature19841 PubMed 27732583