Skip to main content
Addgene

SHP2(C459S)@pLKO-Trex-HA
(Plasmid #85459)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85459 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLKO-trex-HA-DEST-Neo
  • Backbone size w/o insert (bp) 9600
  • Total vector size (bp) 11639
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SHP2
  • Alt name
    PTPN11
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2200
  • Mutation
    C459S
  • Entrez Gene
    PTPN11 (a.k.a. BPTP3, CFC, JMML, METCDS, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2)
  • Promoter RSV
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGACATCGCGGAGATGGTTTCACC
  • 3′ sequencing primer TCATCTGAAACTTTTCTGCTGTTGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SHP2(C459S)@pLKO-Trex-HA was a gift from Darrin Stuart (Addgene plasmid # 85459 ; http://n2t.net/addgene:85459 ; RRID:Addgene_85459)

  • For your References section:

    Allosteric inhibition of SHP2 phosphatase inhibits cancers driven by receptor tyrosine kinases. Chen YN, LaMarche MJ, Chan HM, Fekkes P, Garcia-Fortanet J, Acker MG, Antonakos B, Chen CH, Chen Z, Cooke VG, Dobson JR, Deng Z, Fei F, Firestone B, Fodor M, Fridrich C, Gao H, Grunenfelder D, Hao HX, Jacob J, Ho S, Hsiao K, Kang ZB, Karki R, Kato M, Larrow J, La Bonte LR, Lenoir F, Liu G, Liu S, Majumdar D, Meyer MJ, Palermo M, Perez L, Pu M, Price E, Quinn C, Shakya S, Shultz MD, Slisz J, Venkatesan K, Wang P, Warmuth M, Williams S, Yang G, Yuan J, Zhang JH, Zhu P, Ramsey T, Keen NJ, Sellers WR, Stams T, Fortin PD. Nature. 2016 Jul 7;535(7610):148-52. 10.1038/nature18621 PubMed 27362227
Related items:
Commonly requested with: