pTlpA-Wasabi
(Plasmid #85455)

• Purpose: mWasabi reporter gene gated by wild type TlpA
• Depositing Lab: Mikhail Shapiro
• Publication: Piraner et al Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14.

Backbone

• Vector backbone: pETDuet-1
• Backbone manufacturer: Novagen
• Modifications to backbone: Replaced T7 Promoter #1 with TlpA Promoter. Replaced T7 Promoter #2 with LacI Promoter.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: TlpA
• Species: S. Typhimurium
• Insert Size (bp): 1116
• Mutation: D341A
• GenBank ID: M88208.1
• Promoter: TlpA, LacI

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: gcttgcggccgcataa
• 3′ sequencing primer: CTAGTTATTGCTCAGCGGTG

Gene/Insert 2

• Gene/Insert name: mWasabi
• Species: Synthetic
• Insert Size (bp): 756
• GenBank ID: EU024648.1
• Promoter: TlpA
• Tag / Fusion Protein:
  • 6xHis (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATGCGTCCGGCGTAGA
• 3′ sequencing primer: ttatgcggccgcaagc

Resource Information

• Supplemental Documents:
  • pTlpA-Wasabi.gb
• A portion of this plasmid was derived from a plasmid made by: Dr. B. Brett Finlay at the University of British Columbia.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry