ER50-SpCas9-ER50
(Plasmid #85448)

• Purpose: Expresses SpCas9 fused to ER50 domain on both N- and C-termini in mammalian cells
• Depositing Lab: Amit Choudhary
• Publication: Maji et al Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub 2016 Oct 31.

Backbone

• Vector backbone: px330
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 4234
• Total vector size (bp): 10000
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ER50-SpCas9-ER50
• Alt name: ESpE
• Insert Size (bp): 5766
• Promoter: Cbh
• Tags / Fusion Proteins:
  • destabilized domain of estrogen receptor ligand binding domain (N terminal on insert)
  • destabilized domain of estrogen receptor ligand binding domain (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: agcgaagcgcgcggcgggcg
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • 1178 - ER50_SpCas9_ER50.gb
• A portion of this plasmid was derived from a plasmid made by: Genewiz

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry