Fireworks GFP[PTC+] (AVA2600)
(Plasmid #85446)

• Purpose: Expresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a PTC-containing beta-globin reporter.
• Depositing Lab: Joan Steitz
• Publication: Alexandrov et al Mol Cell. 2017 Jan 5;65(1):191-201. doi: 10.1016/j.molcel.2016.11.032. Epub 2016 Dec 22.

Backbone

• Vector backbone: 2073 nt of YCplac33
• Backbone size w/o insert (bp): 2073
• Total vector size (bp): 11448
• Vector type: Mammalian Expression ; minimal backbone fragment for low-copy bacterial propagation
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: tDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)(PTC39)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
• Insert Size (bp): 9369

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: 5'- GTGAGTTAGCTCACTCATTAGGCACCC -3'
• 3′ sequencing primer: 5'- GTT CCG CGC ACA TTT CCC -3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry