Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV hSyn1 bPAC cMyc S27A 2A tDimer
(Plasmid #85398)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85398 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4568
  • Total vector size (bp) 7176
  • Modifications to backbone
    human Synapsin1 promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    humanized photoactivated adenylyl cyclase
  • Alt name
    bPAC S27A
  • Alt name
    BlaC
  • Alt name
    Beggiatoa sp. PS
  • Species
    GU461306
  • Insert Size (bp)
    1092
  • Mutation
    S27A
  • Promoter human Synapsin1 promotor
  • Tag / Fusion Protein
    • cMyc Tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer tttcgccacctctgactt
  • 3′ sequencing primer GTACTCGGTTTTCAGGCACAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    tdimer2
  • Species
    Discosoma sp.
  • Insert Size (bp)
    1395
  • Promoter ribosomal skip sequence T2A

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ChR2 was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert was described in Stierl et al Biochemistry. 2014 Aug 12;53(31):5121-30. doi: 10.1021/bi500479v. Epub 2014 Jul 28 and cloned behind a neuron-specific promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn1 bPAC cMyc S27A 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 85398 ; http://n2t.net/addgene:85398 ; RRID:Addgene_85398)