pAAV hSyn1 bPAC cMyc S27A 2A tDimer
(Plasmid
#85398)
-
Purposehumanized photoactivated adenylyl cyclase lower dark activity, spectrum shifted 15 nm longer wavelenght with neuron-specific promoter, plus red fluorescent protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4568
- Total vector size (bp) 7176
-
Modifications to backbonehuman Synapsin1 promoter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehumanized photoactivated adenylyl cyclase
-
Alt namebPAC S27A
-
Alt nameBlaC
-
Alt nameBeggiatoa sp. PS
-
SpeciesGU461306
-
Insert Size (bp)1092
-
MutationS27A
- Promoter human Synapsin1 promotor
-
Tag
/ Fusion Protein
- cMyc Tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tttcgccacctctgactt
- 3′ sequencing primer GTACTCGGTTTTCAGGCACAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt nametdimer2
-
SpeciesDiscosoma sp.
-
Insert Size (bp)1395
- Promoter ribosomal skip sequence T2A
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byChR2 was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert was described in Stierl et al Biochemistry. 2014 Aug 12;53(31):5121-30. doi: 10.1021/bi500479v. Epub 2014 Jul 28 and cloned behind a neuron-specific promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hSyn1 bPAC cMyc S27A 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 85398 ; http://n2t.net/addgene:85398 ; RRID:Addgene_85398)