ITSN-mcherry-sspB
(Plasmid #85220)

• Purpose: Role of Cdc-42 selective GEF domain from ITSN in immune cell migration
• Depositing Lab: Narasimhan Gautam
• Publication: O'Neill et al Mol Biol Cell. 2016 May 1;27(9):1442-50. doi: 10.1091/mbc.E15-12-0832. Epub 2016 Mar 3.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 7585
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ITSN1(1225-1575)
• Alt name: Intersectin 1
• Species: H. sapiens (human)
• GenBank ID: NM_001331010
• Entrez Gene: ITSN1 (a.k.a. ITSN, SH3D1A, SH3P17)
• Promoter: CMV
• Tag / Fusion Protein:
  • NA

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: T7 primer
• 3′ sequencing primer: BGH reverse primer

Gene/Insert 2

• Gene/Insert name: mcherry
• Species: Synthetic
• Insert Size (bp): 710
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (destroyed during cloning)
• 3′ cloning site: BspE1 (not destroyed)
• 5′ sequencing primer: cttccacatctcccacattgac

Gene/Insert 3

• Gene/Insert name: sspB
• Species: bacterial
• Insert Size (bp): 342
• Mutation: R73Q
• Promoter: CMV

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspE1 (destroyed during cloning)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ggactacaccatcgtggaacagtacgaacg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry