Skip to main content
Addgene

Banshee-ShCit-A
(Plasmid #85216)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85216 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Banshee-GFP
  • Backbone size w/o insert (bp) 6530
  • Modifications to backbone
    H1 promoter to drive hairpin expression was inserted upstream of hairpin cloning sites and cannot be removed. Hairpin can be excised with Bgl2 and Hind3 digest.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shCit-A
  • gRNA/shRNA sequence
    GACGACATGCACCATGCTGTTCAAGAGACAGCATGGTGCATGTCGTCTTTTT
  • Species
    M. musculus (mouse)
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl2 (not destroyed)
  • 3′ cloning site Hind3 (unknown if destroyed)
  • 5′ sequencing primer gaacgctgacgtcatcaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Banshee-ShCit-A was a gift from Alex Minella (Addgene plasmid # 85216 ; http://n2t.net/addgene:85216 ; RRID:Addgene_85216)
  • For your References section:

    E2F-2 promotes nuclear condensation and enucleation of terminally differentiated erythroblasts. Swartz KL, Wood SN, Murthy T, Ramirez O, Qin G, Pillai MM, Rao S, Minella AC. Mol Cell Biol. 2016 Oct 17. pii: MCB.00274-16. 10.1128/MCB.00274-16 PubMed 27795297