Banshee-ShCit-A
(Plasmid
#85216)
-
PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBanshee-GFP
- Backbone size w/o insert (bp) 6530
-
Modifications to backboneH1 promoter to drive hairpin expression was inserted upstream of hairpin cloning sites and cannot be removed. Hairpin can be excised with Bgl2 and Hind3 digest.
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshCit-A
-
gRNA/shRNA sequenceGACGACATGCACCATGCTGTTCAAGAGACAGCATGGTGCATGTCGTCTTTTT
-
SpeciesM. musculus (mouse)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl2 (not destroyed)
- 3′ cloning site Hind3 (unknown if destroyed)
- 5′ sequencing primer gaacgctgacgtcatcaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Banshee-ShCit-A was a gift from Alex Minella (Addgene plasmid # 85216 ; http://n2t.net/addgene:85216 ; RRID:Addgene_85216) -
For your References section:
E2F-2 promotes nuclear condensation and enucleation of terminally differentiated erythroblasts. Swartz KL, Wood SN, Murthy T, Ramirez O, Qin G, Pillai MM, Rao S, Minella AC. Mol Cell Biol. 2016 Oct 17. pii: MCB.00274-16. 10.1128/MCB.00274-16 PubMed 27795297