LeGO-S2
(Plasmid #85211)

• Purpose: Lentiviral vector expressing T-Sapphire fluorescent protein driven by SFFV promoter
• Depositing Lab: Boris Fehse
• Publication: Mohme et al Mol Ther. 2017 Jan 18. pii: S1525-0016(16)45496-1. doi: 10.1016/j.ymthe.2016.12.014.

Backbone

• Vector backbone: LeGO vector
• Backbone size w/o insert (bp): 6417
• Total vector size (bp): 7137
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: T-Sapphire
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: SFFV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI, NcoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GAGCTCACAACCCCTCACTC

Resource Information

• Supplemental Documents:
  • Map as PDF
• A portion of this plasmid was derived from a plasmid made by: T-Sapphire cDNA was a kind gift from Dr. Oliver Griesbeck (MPI of Neurobiology, Martinsried, Germany). The lenti backbone is a derivative of pLentiLox3.7 (Addgene plasmid #11795) developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de

The BsrGI site of T-Sapphire can be used to fuse an antibiotic resistance to the fluorescent protein following the building block principle of the LeGO vector system. More information is available on the LeGO website and in the following publications.

More references:
Weber et al., Molecular Therapy, 2008:
http://www.nature.com/mt/journal/v16/n4/full/mt20086a.html
Weber et al., Gene Therapy, 2010:
http://www.nature.com/gt/journal/v17/n4/full/gt2009149a.html