Skip to main content
Addgene

LeGO-S2
(Plasmid #85211)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85211 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LeGO vector
  • Backbone size w/o insert (bp) 6417
  • Total vector size (bp) 7137
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    T-Sapphire
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI, NcoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GAGCTCACAACCCCTCACTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    T-Sapphire cDNA was a kind gift from Dr. Oliver Griesbeck (MPI of Neurobiology, Martinsried, Germany). The lenti backbone is a derivative of pLentiLox3.7 (Addgene plasmid #11795) developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de

The BsrGI site of T-Sapphire can be used to fuse an antibiotic resistance to the fluorescent protein following the building block principle of the LeGO vector system. More information is available on the LeGO website and in the following publications.

More references:
Weber et al., Molecular Therapy, 2008:
http://www.nature.com/mt/journal/v16/n4/full/mt20086a.html
Weber et al., Gene Therapy, 2010:
http://www.nature.com/gt/journal/v17/n4/full/gt2009149a.html

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LeGO-S2 was a gift from Boris Fehse (Addgene plasmid # 85211 ; http://n2t.net/addgene:85211 ; RRID:Addgene_85211)
  • For your References section:

    Optical Barcoding for Single-Clone Tracking to Study Tumor Heterogeneity. Mohme M, Maire CL, Riecken K, Zapf S, Aranyossy T, Westphal M, Lamszus K, Fehse B. Mol Ther. 2017 Jan 18. pii: S1525-0016(16)45496-1. doi: 10.1016/j.ymthe.2016.12.014. 10.1016/j.ymthe.2016.12.014 PubMed 28109958