pLKO.1-TRC.mKO2
(Plasmid #85208)

• Purpose: (Empty Backbone) Backbone for lentiviral gene silencing with monomeric Kusabira-Orange2 expression
• Depositing Lab: Sandra Martha Gomes Dias
• Publication: Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 10.1186/s12885-017-3726-2.

Backbone

• Vector backbone: pLKO.1 - TRC cloning vector
• Backbone manufacturer: David Root (Addgene #10878)
• Backbone size (bp): 7032
• Modifications to backbone: Puromycin N-acetyltransferase resistance was removed with BamHI and KpnI and inserted monomeric Kusabira-Orange2 for fluorescence expression.
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Promoter: RNA polymerase III promoter for human U6 snRNA for shRNA and hPGK promoter for mKO2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Resource Information

• Supplemental Documents:
  • pLKO.1-TRC.mKO2.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 1.9kb stuffer can be released with AgeI and EcoRI and replaced with your shRNA sequence of choice.

Also, see Addgene's pLKO.1 protocol http://www.addgene.org/plko on how to use the pLKO.1 vector.

Plasmid grows more slowly than standard plasmids.