pSB1A3 EcoRI Methylase-AmilCP
(Plasmid #85166)

• Purpose: For methylating EcoRI recognition sites in order to prevent cleavage by the EcoRI restriction enzyme. AmilCP is a blue reporter for Methylase expression.
• Depositing Lab: Robin Dowell
• Publication: Hendrix et al ACS Synth Biol. 2014 Dec 19;3(12):969-71. doi: 10.1021/sb500042m.

Backbone

• Vector backbone: pSB1A3
• Backbone manufacturer: iGEM
• Backbone size w/o insert (bp): 2155
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EcoRI Methylase-AmilCP
• Alt name: AmilCP tagged Methylase
• Species: E. coli strain RY13
• Insert Size (bp): 1721
• Promoter: J23100 promoter
• Tag / Fusion Protein:
  • AmilCP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI, XbaI (not destroyed)
• 3′ cloning site: SpeI, PstI (not destroyed)
• 5′ sequencing primer: VF2 (5' tgccacctgacgtctaagaa 3')
• 3′ sequencing primer: VR (5' attaccgcctttgagtgagc 3')

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Promoter and AmilCP were acquired from iGEM repository.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The methylase will methylate the EcoRI cloning site, rendering the site nonfunctional.