pYES260-sc.eEF2 K509A
(Plasmid
#85120)
-
Purposeyeast expression of mutant EEF2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85120 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepYES260
-
Backbone manufacturerEuroscarf (Melcher)
- Backbone size w/o insert (bp) 5933
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGGACTACTAGCAGCTGTAATACGACTC
- 3′ sequencing primer CTAATTACATGATGCGGCCCTCTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYES260-sc.eEF2 K509A was a gift from Pal Falnes (Addgene plasmid # 85120 ; http://n2t.net/addgene:85120 ; RRID:Addgene_85120) -
For your References section:
Identification and characterization of a novel evolutionarily conserved lysine-specific methyltransferase targeting eukaryotic translation elongation factor 2 (eEF2). Davydova E, Ho AY, Malecki J, Moen A, Enserink JM, Jakobsson ME, Loenarz C, Falnes PO. J Biol Chem. 2014 Oct 31;289(44):30499-510. doi: 10.1074/jbc.M114.601658. Epub 2014 Sep 17. 10.1074/jbc.M114.601658 PubMed 25231979