Skip to main content
Addgene

pF713-pEGFP-N1-Hs-FL-METTL20 wt
(Plasmid #85114)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85114 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-N1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human full-length METTL20
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    786
  • Entrez Gene
    METTL20 (a.k.a. C12orf72, MGC50559)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Homo sapiens wt METTL20, full-length, cloned into SacI-SacII sites of pEGFP-N1, in frame with EGFP, no STOP codon between METTL20 and EGFP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF713-pEGFP-N1-Hs-FL-METTL20 wt was a gift from Pal Falnes (Addgene plasmid # 85114 ; http://n2t.net/addgene:85114 ; RRID:Addgene_85114)

  • For your References section:

    Human METTL20 is a mitochondrial lysine methyltransferase that targets the beta subunit of electron transfer flavoprotein (ETFbeta) and modulates its activity. Malecki J, Ho AY, Moen A, Dahl HA, Falnes PO. J Biol Chem. 2015 Jan 2;290(1):423-34. doi: 10.1074/jbc.M114.614115. Epub 2014 Nov 21. 10.1074/jbc.M114.614115 PubMed 25416781
Related items:
Commonly requested with: