Skip to main content
Addgene

pF708-pET28a-Hs-delta38-METTL20-NHis wt
(Plasmid #85109)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85109 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human mature (delta38) METTL20
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    675
  • Entrez Gene
    METTL20 (a.k.a. C12orf72, MGC50559)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ATGCGTCCGGCGTAGAGG
  • 3′ sequencing primer TAGAGGCCCCAAGGGGTTATGCTAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Homo sapiens wt METTL20, delta 38, cloned into NdeI-BamHI sites of pET28a, contains a N-terminal His-tag

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF708-pET28a-Hs-delta38-METTL20-NHis wt was a gift from Pal Falnes (Addgene plasmid # 85109 ; http://n2t.net/addgene:85109 ; RRID:Addgene_85109)
  • For your References section:

    Human METTL20 is a mitochondrial lysine methyltransferase that targets the beta subunit of electron transfer flavoprotein (ETFbeta) and modulates its activity. Malecki J, Ho AY, Moen A, Dahl HA, Falnes PO. J Biol Chem. 2015 Jan 2;290(1):423-34. doi: 10.1074/jbc.M114.614115. Epub 2014 Nov 21. 10.1074/jbc.M114.614115 PubMed 25416781