Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTriEx-RhoA-wt_mScarlet-i_SGFP2
(Plasmid #85071)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85071 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTriEx
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5043
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RhoA Biosensor wildtype with mScarlet-i and SGFP2
  • Alt name
    RHOA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2436
  • Entrez Gene
    RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 6xHis (C terminal on backbone)
    • mScarlet-i and SGFP2 (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGTGAGCCAGGGCATTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTriEx-RhoA-wt_mScarlet-i_SGFP2 was a gift from Dorus Gadella (Addgene plasmid # 85071 ; http://n2t.net/addgene:85071 ; RRID:Addgene_85071)
  • For your References section:

    mScarlet: a bright monomeric red fluorescent protein for cellular imaging. Bindels DS, Haarbosch L, van Weeren L, Postma M, Wiese KE, Mastop M, Aumonier S, Gotthard G, Royant A, Hink MA, Gadella TW Jr. Nat Methods. 2016 Nov 21. doi: 10.1038/nmeth.4074. 10.1038/nmeth.4074 PubMed 27869816