pK037.CAG-FRT-stop-FRT-RFP-ires-tTA-WPRE (Supernova)
(Plasmid #85038)

• Purpose: For Flpe/FRT-based Supernova-RFP, pK037 should be used with pK036.
• Depositing Lab: Takuji Iwasato
• Publication: Luo et al Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747.

Backbone

• Vector backbone: pK029.CAG-loxP-stop-loxP-RFP-ires-tTA-WPRE (Supernova)
• Backbone size w/o insert (bp): 8839
• Total vector size (bp): 10266
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FRT-stop-FRT
• Species: S. cerevisiae (budding yeast); SV40
• Insert Size (bp): 1427

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GCTAACCATGTTCATGCCTTCTTCTTTTTC

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Backbone plasmid (pK029) is available in Addgene. Please note that the Addgene verified sequence differs from the depositor's sequence but should not affect plasmid function.