-
PurposeFor Flpe/FRT-based Supernova-RFP, pK037 should be used with pK036.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85038 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepK029.CAG-loxP-stop-loxP-RFP-ires-tTA-WPRE (Supernova)
- Backbone size w/o insert (bp) 8839
- Total vector size (bp) 10266
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFRT-stop-FRT
-
SpeciesS. cerevisiae (budding yeast); SV40
-
Insert Size (bp)1427
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCTAACCATGTTCATGCCTTCTTCTTTTTC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Backbone plasmid (pK029) is available in Addgene. Please note that the Addgene verified sequence differs from the depositor's sequence but should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK037.CAG-FRT-stop-FRT-RFP-ires-tTA-WPRE (Supernova) was a gift from Takuji Iwasato (Addgene plasmid # 85038 ; http://n2t.net/addgene:85038 ; RRID:Addgene_85038) -
For your References section:
Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Luo W, Mizuno H, Iwata R, Nakazawa S, Yasuda K, Itohara S, Iwasato T. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. 10.1038/srep35747 PubMed 27775045