Skip to main content
Addgene

pPTK001-2-pAOX1
(Plasmid #84960)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84960 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pYTK001-EntryVector
  • Backbone manufacturer
    Lee et al. (2015), ACS Synth. Biol. 4, 975–986.
  • Backbone size w/o insert (bp) 1662
  • Total vector size (bp) 2605
  • Vector type
    Yeast Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Alcohol oxidase 1 promoter
  • Alt name
    pAOX1
  • Species
    Synthetic; Pichia pastoris
  • Insert Size (bp)
    939
  • Promoter Non

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer ccttttgctggccttttgctc
  • 3′ sequencing primer ccagtaatgacctcagaactcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Design of this plasmid was performed according to the described Methods in Lee et al. 2015 (A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly) and this plasmid is compatible with the existing toolkit (MoClo-YTK, Kit number 1000000061)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPTK001-2-pAOX1 was a gift from Volker Sieber (Addgene plasmid # 84960 ; http://n2t.net/addgene:84960 ; RRID:Addgene_84960)
  • For your References section:

    A Modular Toolkit for Generating Pichia pastoris Secretion Libraries. Obst U, Lu TK, Sieber V. ACS Synth Biol. 2017 Mar 15. doi: 10.1021/acssynbio.6b00337. 10.1021/acssynbio.6b00337 PubMed 28252957