pAav-MDM2-PQS2-3xHA
(Plasmid #84886)

• Purpose: rAAV-based template for genome engineering of the MDM2 protein C-terminus containing PQS2 and 3xHA tags and a selection cassette
• Depositing Lab: Sven Eyckerman
• Publication: Vandemoortele et al Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAav-MCS-PQS2-3xHA
• Backbone manufacturer: Eyckerman lab
• Backbone size w/o insert (bp): 4890
• Total vector size (bp): 6877
• Vector type: AAV
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: MDM2 genomic sequence HR1
• Alt name: HDM2
• Species: H. sapiens (human)
• Insert Size (bp): 1020
• Entrez Gene: MDM2 (a.k.a. ACTFS, HDMX, LSKB, hdm2)
• Promoter: no
• Tag / Fusion Protein:
  • PQS2 3xHA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCTCTGACTTGAGCGTCGAT
• 3′ sequencing primer: TAGGGCGCGATAACTTCGTA

Gene/Insert 2

• Gene/Insert name: MDM2 genomic insert HR2
• Alt name: HDM2
• Species: H. sapiens (human)
• Insert Size (bp): 1008
• Entrez Gene: MDM2 (a.k.a. ACTFS, HDMX, LSKB, hdm2)
• Promoter: no

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGGAGGATTGGGAAGACAAT
• 3′ sequencing primer: TACTATGGTTGCTTTGACGT

Resource Information

• Supplemental Documents:
  • pAav-MDM2-Cter PQS2 3xHA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Sequencing over ITR sequences may be difficult