Skip to main content
Addgene

pCFJ1320
(Plasmid #84829)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84829 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDESTR4-R3
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Bacterial Expression, Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C. elegans codon optimized GFP
  • Species
    C. elegans (nematode)
  • Promoter Peft-3

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GAACAGCTATGACCATGATTACG
  • 3′ sequencing primer M13F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expression vector with C. elegans codon-optimized GFP under the eft-3 promoter and with the tbb-2 3'UTR.
Cloned into pCFJ150 for compatibility with mosSCI.
Contains cbr-unc-119 rescue fragment.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFJ1320 was a gift from Andrew Fire (Addgene plasmid # 84829 ; http://n2t.net/addgene:84829 ; RRID:Addgene_84829)
  • For your References section:

    An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silencing in the C. elegans Germline. Frokjaer-Jensen C, Jain N, Hansen L, Davis MW, Li Y, Zhao D, Rebora K, Millet JR, Liu X, Kim SK, Dupuy D, Jorgensen EM, Fire AZ. Cell. 2016 Jul 14;166(2):343-57. doi: 10.1016/j.cell.2016.05.072. Epub 2016 Jun 30. 10.1016/j.cell.2016.05.072 PubMed 27374334