pY095
(Plasmid #84744)

• Purpose: Expresses huLbCpf1-T2A-GFP and crRNA guide
• Depositing Lab: Feng Zhang
• Publication: Zetsche et al Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5620
• Total vector size (bp): 10269
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: huLbCpf1
• Alt name: huLbCas12a
• Species: Synthetic
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Gene/Insert 2

• Gene/Insert name: GFP
• Species: Synthetic
• Tag / Fusion Protein:
  • T2A (N terminal on insert)

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by:
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Modified pY027 plasmid with T2A-GFP after huLbCpf1.
Contains a BsmBI cloning cassette for U6 driven crRNA expression.